|
OriGene
rt pcr primer pairs hp200154 for gla Rt Pcr Primer Pairs Hp200154 For Gla, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+pairs/pm42268866-65-0-15?v=OriGene Average 94 stars, based on 1 article reviews
rt pcr primer pairs hp200154 for gla - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
OriGene
hp200179 for hprt1 Hp200179 For Hprt1, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+pairs/pm42268866-65-8-15?v=OriGene Average 94 stars, based on 1 article reviews
hp200179 for hprt1 - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
Jackson Laboratory
primer pairs Primer Pairs, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+pairs/pm42269604-216-7-11?v=Jackson+Laboratory Average 86 stars, based on 1 article reviews
primer pairs - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
primer pairs Primer Pairs, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+pairs/pm42250666-137-30-32?v=Sangon+Biotech Average 86 stars, based on 1 article reviews
primer pairs - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
|
Yeasen Biotechnology
primer pairs Primer Pairs, supplied by Yeasen Biotechnology, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+pairs/pm42240328-316-13-22?v=Yeasen+Biotechnology Average 86 stars, based on 1 article reviews
primer pairs - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
|
OriGene
ggtccaagtgatgctcaatggg Ggtccaagtgatgctcaatggg, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+pairs/pm42244013-162-8-13?v=OriGene Average 94 stars, based on 1 article reviews
ggtccaagtgatgctcaatggg - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
OriGene
il 6 Il 6, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+pairs/pm42231787-79-4-6?v=OriGene Average 94 stars, based on 1 article reviews
il 6 - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
OriGene
gene expression Gene Expression, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+pairs/pm42231787-79-8-13?v=OriGene Average 94 stars, based on 1 article reviews
gene expression - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
OriGene
gaatgccaccttcatccgagaag reverse Gaatgccaccttcatccgagaag Reverse, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+pairs/pm42234557-282-119-122?v=OriGene Average 94 stars, based on 1 article reviews
gaatgccaccttcatccgagaag reverse - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
OriGene
gcgacatactcaagcaggagca reverse Gcgacatactcaagcaggagca Reverse, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+pairs/pm42234557-282-130-133?v=OriGene Average 94 stars, based on 1 article reviews
gcgacatactcaagcaggagca reverse - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |