Review





Similar Products

94
OriGene rt pcr primer pairs hp200154 for gla
Rt Pcr Primer Pairs Hp200154 For Gla, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+pairs/pm42268866-65-0-15?v=OriGene
Average 94 stars, based on 1 article reviews
rt pcr primer pairs hp200154 for gla - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

94
OriGene hp200179 for hprt1
Hp200179 For Hprt1, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+pairs/pm42268866-65-8-15?v=OriGene
Average 94 stars, based on 1 article reviews
hp200179 for hprt1 - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

86
Jackson Laboratory primer pairs
Primer Pairs, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+pairs/pm42269604-216-7-11?v=Jackson+Laboratory
Average 86 stars, based on 1 article reviews
primer pairs - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

86
Sangon Biotech primer pairs
Primer Pairs, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+pairs/pm42250666-137-30-32?v=Sangon+Biotech
Average 86 stars, based on 1 article reviews
primer pairs - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

86
Yeasen Biotechnology primer pairs
Primer Pairs, supplied by Yeasen Biotechnology, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+pairs/pm42240328-316-13-22?v=Yeasen+Biotechnology
Average 86 stars, based on 1 article reviews
primer pairs - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

94
OriGene ggtccaagtgatgctcaatggg
Ggtccaagtgatgctcaatggg, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+pairs/pm42244013-162-8-13?v=OriGene
Average 94 stars, based on 1 article reviews
ggtccaagtgatgctcaatggg - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

94
OriGene il 6
Il 6, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+pairs/pm42231787-79-4-6?v=OriGene
Average 94 stars, based on 1 article reviews
il 6 - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

94
OriGene gene expression
Gene Expression, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+pairs/pm42231787-79-8-13?v=OriGene
Average 94 stars, based on 1 article reviews
gene expression - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

94
OriGene gaatgccaccttcatccgagaag reverse
Gaatgccaccttcatccgagaag Reverse, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+pairs/pm42234557-282-119-122?v=OriGene
Average 94 stars, based on 1 article reviews
gaatgccaccttcatccgagaag reverse - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

94
OriGene gcgacatactcaagcaggagca reverse
Gcgacatactcaagcaggagca Reverse, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+pairs/pm42234557-282-130-133?v=OriGene
Average 94 stars, based on 1 article reviews
gcgacatactcaagcaggagca reverse - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

Image Search Results